Product Details

SNP ID: rs149581413
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:88876451 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTTTCTCCCTTTTTAATCAGGAG[A/G]GGGAGAACCCCCCCGTTTTCTTTGT
Phenotype: MIM: 603870
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CBFA2T3 PubMed Links

Gene Details

Gene: CBFA2T3
Gene Name: CBFA2/RUNX1 translocation partner 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005187.5	2442	UTR 3			NP_005178.4
NM_175931.2	2442	UTR 3			NP_787127.1
XM_005256323.4	2442	UTR 3			XP_005256380.1
XM_011523419.2	2442	Intron			XP_011521721.1
XM_017023811.1	2442	Intron			XP_016879300.1

Gene: LOC101927793
Gene Name: uncharacterized LOC101927793

There are no transcripts associated with this gene.

Gene: PABPN1L
Gene Name: poly(A) binding protein nuclear 1 like (cytoplasmic)

There are no transcripts associated with this gene.

View Full Product Details