Product Details
- SNP ID
-
rs112418428
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
11
- Location
-
Chr.1:241631596 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCTGTCTAGTCTCATTTTCCTCACA[C/T]ATAGAGGAGCAAAAATTAGTGTATT
- Phenotype
-
MIM: 118825
MIM: 606695
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CHML
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs145080786] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CHML
- Gene Name
- CHM like, Rab escort protein 2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001821.3 |
4335 |
UTR 3 |
|
|
NP_001812.2 |
- Gene
- OPN3
- Gene Name
- opsin 3
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_014322.2 |
4335 |
Intron |
|
|
NP_055137.2 |
View Full Product Details