Product Details

SNP ID: rs146800609
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 16
Location: Chr.1:232955719 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCCGGGGGCCTTTATCGAGAGTTG[A/G]GTACTGATATTTCATTTCTGTGGTG
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: NTPCR PubMed Links
Additional Information: For this assay, SNP(s) [rs12725558] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.