Product Details

SNP ID: rs141788096
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:10440743 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTATCTACACATTAATACTAGCC[A/G]AAGCACAGGCTGCTCTGTGGCGTTT
Phenotype: MIM: 165640
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101929715 PubMed Links

Gene Details

Gene: LOC101929715
Gene Name: uncharacterized LOC101929715

There are no transcripts associated with this gene.

Gene: ODC1
Gene Name: ornithine decarboxylase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001287188.1	1928	Missense Mutation	TCG,TTG	S327L	NP_001274117.1
NM_001287189.1	1928	Missense Mutation	TCG,TTG	S456L	NP_001274118.1
NM_001287190.1	1928	Missense Mutation	TCG,TTG	S456L	NP_001274119.1
NM_002539.2	1928	Missense Mutation	TCG,TTG	S456L	NP_002530.1

Gene: SNORA80B
Gene Name: small nucleolar RNA, H/ACA box 80B

There are no transcripts associated with this gene.

View Full Product Details