Product Details

SNP ID: rs150336032
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:32628368 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCGGCAGCAATGGAAACAGGAGGGG[G/T]TCGTCGGTTCAGGTGAGAGGCGCAC
Phenotype: MIM: 605638
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: BIRC6 PubMed Links

Gene Details

Gene: BIRC6
Gene Name: baculoviral IAP repeat containing 6

There are no transcripts associated with this gene.

Gene: MIR4765
Gene Name: microRNA 4765

There are no transcripts associated with this gene.

Gene: TTC27
Gene Name: tetratricopeptide repeat domain 27

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193509.1	349	Intron			NP_001180438.1
NM_017735.4	349	Missense Mutation	GTC,TTC	V26F	NP_060205.3
XM_005264416.1	349	Missense Mutation	GTC,TTC	V26F	XP_005264473.1
XM_011532958.1	349	Missense Mutation	GTC,TTC	V26F	XP_011531260.1

View Full Product Details