Product Details

SNP ID

rs149148720

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.5:138140730 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTGAATCTGCTCCAGGACTTCTTGC[C/T]GCATCTCCACAGCCATATGGTATAC

Phenotype

MIM: 602848 MIM: 603575

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

BRD8 PubMed Links

Additional Information

For this assay, SNP(s) [rs412051] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

BRD8

Gene Name

bromodomain containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164326.1	3693	Intron			NP_001157798.1
NM_001300961.1	3693	Intron			NP_001287890.1
NM_001300962.1	3693	Intron			NP_001287891.1
NM_001300966.1	3693	Intron			NP_001287895.1
NM_006696.3	3693	Intron			NP_006687.3
NM_139199.1	3693	Missense Mutation	CAG,CGG	Q1197R	NP_631938.1
XM_005271855.2	3693	Missense Mutation	CAG,CGG	Q1270R	XP_005271912.1
XM_005271856.2	3693	Missense Mutation	CAG,CGG	Q1255R	XP_005271913.1
XM_005271857.2	3693	Missense Mutation	CAG,CGG	Q1200R	XP_005271914.1
XM_005271859.3	3693	Missense Mutation	CAG,CGG	Q1127R	XP_005271916.1
XM_005271860.3	3693	Intron			XP_005271917.1
XM_005271861.3	3693	Intron			XP_005271918.1
XM_011543109.1	3693	Missense Mutation	CAG,CGG	Q1216R	XP_011541411.1
XM_011543110.1	3693	Missense Mutation	CAG,CGG	Q1137R	XP_011541412.1
XM_017008969.1	3693	Missense Mutation	CAG,CGG	Q1143R	XP_016864458.1
XM_017008970.1	3693	Intron			XP_016864459.1
XM_017008971.1	3693	Intron			XP_016864460.1
XM_017008972.1	3693	Intron			XP_016864461.1
XM_017008973.1	3693	Intron			XP_016864462.1
XM_017008974.1	3693	Intron			XP_016864463.1
XM_017008975.1	3693	Intron			XP_016864464.1
XM_017008976.1	3693	Intron			XP_016864465.1

Gene

NME5

Gene Name

NME/NM23 family member 5

There are no transcripts associated with this gene.

View Full Product Details