Product Details

SNP ID: rs115814584
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144529467 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCAGCAGCTCTGGCCCCGAGAAC[A/G]GACAGTCCCGGGCCCGGCGCCTTCC
Phenotype: MIM: 615880
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARHGAP39 PubMed Links

Gene Details

Gene: ARHGAP39
Gene Name: Rho GTPase activating protein 39

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308207.1	4566	UTR 3			NP_001295136.1
NM_001308208.1	4566	UTR 3			NP_001295137.1
NM_025251.2	4566	UTR 3			NP_079527.1
XM_011517308.1	4566	UTR 3			XP_011515610.1
XM_011517309.1	4566	UTR 3			XP_011515611.1
XM_011517312.2	4566	UTR 3			XP_011515614.1
XM_017013870.1	4566	UTR 3			XP_016869359.1
XM_017013871.1	4566	UTR 3			XP_016869360.1

Gene: C8orf82
Gene Name: chromosome 8 open reading frame 82

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001795.1	4566	Intron			NP_001001795.1

Gene: LRRC14
Gene Name: leucine rich repeat containing 14

There are no transcripts associated with this gene.

Gene: LRRC24
Gene Name: leucine rich repeat containing 24

There are no transcripts associated with this gene.

View Full Product Details