Product Details

SNP ID
rs115821379
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.8:71198811 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TTTAAAAAAGTCTGGTGGGTGAATT[A/G]TACCTCAATAAAGCTGTTTTTTTAT
Phenotype
MIM: 601653
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
EYA1 PubMed Links
Additional Information
For this assay, SNP(s) [rs141811307] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
EYA1
Gene Name
EYA transcriptional coactivator and phosphatase 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_000503.5 2948 UTR 3 NP_000494.2
NM_001288574.1 2948 UTR 3 NP_001275503.1
NM_001288575.1 2948 UTR 3 NP_001275504.1
NM_172058.3 2948 UTR 3 NP_742055.1
NM_172059.3 2948 UTR 3 NP_742056.1
NM_172060.3 2948 UTR 3 NP_742057.1
XM_011517483.2 2948 UTR 3 XP_011515785.1
XM_011517484.2 2948 UTR 3 XP_011515786.2
XM_017013201.1 2948 UTR 3 XP_016868690.1
XM_017013202.1 2948 UTR 3 XP_016868691.1
XM_017013203.1 2948 UTR 3 XP_016868692.1
XM_017013204.1 2948 UTR 3 XP_016868693.1
XM_017013205.1 2948 Intron XP_016868694.1
XM_017013206.1 2948 UTR 3 XP_016868695.1
XM_017013207.1 2948 UTR 3 XP_016868696.1
XM_017013208.1 2948 UTR 3 XP_016868697.1
XM_017013209.1 2948 UTR 3 XP_016868698.1
XM_017013210.1 2948 UTR 3 XP_016868699.1
XM_017013211.1 2948 UTR 3 XP_016868700.1
XM_017013212.1 2948 UTR 3 XP_016868701.1
XM_017013213.1 2948 UTR 3 XP_016868702.1

View Full Product Details