Product Details

SNP ID: rs150800099
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:53428638 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGAGAATTATACAGGTAAGCAGCC[C/T]GGCCCTCCAGACTCAGAGACCTGAG
Phenotype: MIM: 300256 MIM: 300040
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HSD17B10 PubMed Links

Gene Details

Gene: HSD17B10
Gene Name: hydroxysteroid 17-beta dehydrogenase 10

There are no transcripts associated with this gene.

Gene: RIBC1
Gene Name: RIB43A domain with coiled-coils 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031745.4	793	Intron			NP_001026915.1
NM_001267053.3	793	Intron			NP_001253982.1
NM_144968.3	793	Silent Mutation	CCC,CCT	P185P	NP_659405.1
XM_005261988.3	793	Intron			XP_005262045.1
XM_005261990.3	793	Intron			XP_005262047.1

Gene: SMC1A
Gene Name: structural maintenance of chromosomes 1A

There are no transcripts associated with this gene.

View Full Product Details