Product Details

SNP ID: rs11466338
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:41339896 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTAAGATCTGGTGGTGAAGGAGCC[T/C]GGGAGCAGGGCTGATTTTCTGGCAG
Phenotype: MIM: 190180
Polymorphism: T/C, Transition Substitution
Allele Nomenclature
Literature Links: TGFB1 PubMed Links
Additional Information: For this assay, SNP(s) [rs200419705] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011527242.1		Intron			XP_011525544.1