Product Details

SNP ID: rs183430322
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:56184723 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGTCCGCGGCCCCGCCCGCGCCGGT[G/T]GAGGACCTGTCCAAAGTGTCGGACG
Phenotype
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CCDC85A PubMed Links

Gene Details

Gene: CCDC85A
Gene Name: coiled-coil domain containing 85A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080433.1	601	Silent Mutation	GTG,GTT	V33V	NP_001073902.1
XM_005264125.1	601	Silent Mutation	GTG,GTT	V33V	XP_005264182.1

Gene: LOC100129434
Gene Name: uncharacterized LOC100129434

There are no transcripts associated with this gene.

Gene: LOC105374690
Gene Name: uncharacterized LOC105374690

There are no transcripts associated with this gene.

Gene: LOC107985795
Gene Name: uncharacterized LOC107985795

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017005442.1	601	Intron			XP_016860931.1

View Full Product Details