Product Details

SNP ID: rs189411788
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:45013715 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAAGTGGTAGCCTCTGAGCTAGGCT[A/G]TGTGTTCCAAGCCATCACCCTTACC
Phenotype: MIM: 613521
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HECTD3 PubMed Links

Gene Details

Gene: HECTD3
Gene Name: HECT domain E3 ubiquitin protein ligase 3

There are no transcripts associated with this gene.

Gene: UROD
Gene Name: uroporphyrinogen decarboxylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000374.4	505	Missense Mutation	TAT,TGT	Y133C	NP_000365.3
XM_005271169.1	505	Missense Mutation	TAT,TGT	Y61C	XP_005271226.1
XM_005271170.1	505	Missense Mutation	TAT,TGT	Y61C	XP_005271227.1

Gene: ZSWIM5
Gene Name: zinc finger SWIM-type containing 5

There are no transcripts associated with this gene.

View Full Product Details