Product Details

SNP ID: rs200707918
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:54282449 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGTGAAGTTAGAAAAGCCCTGTC[A/G]AAGCAAGAGATGGCTAGTGCTTCAT
Phenotype: MIM: 604478 MIM: 164017 MIM: 601490
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CBX5 PubMed Links

Gene Details

Gene: CBX5
Gene Name: chromobox 5

There are no transcripts associated with this gene.

Gene: HNRNPA1
Gene Name: heterogeneous nuclear ribonucleoprotein A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002136.3	658	Intron			NP_002127.1
NM_031157.3	658	Intron			NP_112420.1
XM_005268826.1	658	Silent Mutation	TCA,TCG	S182S	XP_005268883.1
XM_017019251.1	658	Intron			XP_016874740.1

Gene: NFE2
Gene Name: nuclear factor, erythroid 2

There are no transcripts associated with this gene.

View Full Product Details