Product Details

SNP ID: rs199863727
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:66138157 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGACCAACTCCATTATCTCACTAT[A/T]AAAAAAAAACTATAGGGAAGAGATT
Phenotype: MIM: 616998 MIM: 616874
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: LLPH PubMed Links

Gene Details

Gene: LLPH
Gene Name: LLP homolog, long-term synaptic facilitation

There are no transcripts associated with this gene.

Gene: LLPH-AS1
Gene Name: LLPH antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: TMBIM4
Gene Name: transmembrane BAX inhibitor motif containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282606.1	782	Missense Mutation	AAT,TAT	N221Y	NP_001269535.1
NM_001282609.1	782	Nonsense Mutation	TAA,TTA	*162L	NP_001269538.1
NM_001282610.1	782	Missense Mutation	AAT,TAT	N143Y	NP_001269539.1
NM_016056.3	782	Missense Mutation	AAT,TAT	N174Y	NP_057140.2

View Full Product Details