Product Details

SNP ID: rs200477436
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:64939520 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAACTTTAAGGAGGCGCTTGATGT[C/T]AGGCTCAATGTTGATGGTTGGGAAG
Phenotype: MIM: 608577 MIM: 138319
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHURC1 PubMed Links

Gene Details

Gene: CHURC1
Gene Name: churchill domain containing 1

There are no transcripts associated with this gene.

Gene: CHURC1-FNTB
Gene Name: CHURC1-FNTB readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001202558.1	720	Intron			NP_001189487.1
NM_001202559.1	720	Intron			NP_001189488.1

Gene: GPX2
Gene Name: glutathione peroxidase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002083.3	720	Missense Mutation	AAC,GAC	N181D	NP_002074.2

Gene: RAB15
Gene Name: RAB15, member RAS oncogene family

There are no transcripts associated with this gene.

View Full Product Details