Product Details

SNP ID

rs200680738

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.15:50182700 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGGTGGACCGGCGCAGCAATCAAGT[A/G]GCCCGGGCGCTGCACGACCACCTCG

Phenotype

MIM: 609123 MIM: 603247

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ATP8B4 PubMed Links

Additional Information

For this assay, SNP(s) [rs34490804] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ATP8B4

Gene Name

ATPase phospholipid transporting 8B4 (putative)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024837.3	505	Intron			NP_079113.2
XM_011522046.2	505	Intron			XP_011520348.1
XM_011522047.2	505	Intron			XP_011520349.1
XM_011522048.1	505	Intron			XP_011520350.1
XM_011522049.2	505	Intron			XP_011520351.1
XM_011522051.2	505	Intron			XP_011520353.1
XM_011522052.2	505	Intron			XP_011520354.1
XM_011522053.1	505	Intron			XP_011520355.1
XM_011522056.2	505	Intron			XP_011520358.2
XM_011522058.2	505	Intron			XP_011520360.1
XM_011522059.1	505	Intron			XP_011520361.1
XM_011522060.1	505	Intron			XP_011520362.1
XM_011522061.1	505	Intron			XP_011520363.1
XM_011522062.1	505	Intron			XP_011520364.1
XM_011522063.1	505	Intron			XP_011520365.1
XM_011522064.1	505	Intron			XP_011520366.1
XM_011522069.2	505	Intron			XP_011520371.1
XM_011522070.1	505	Intron			XP_011520372.1
XM_017022587.1	505	Intron			XP_016878076.1
XM_017022588.1	505	Intron			XP_016878077.1
XM_017022589.1	505	Intron			XP_016878078.1
XM_017022590.1	505	Intron			XP_016878079.1
XM_017022591.1	505	Intron			XP_016878080.1
XM_017022592.1	505	Intron			XP_016878081.1
XM_017022593.1	505	Intron			XP_016878082.1
XM_017022594.1	505	Intron			XP_016878083.1
XM_017022595.1	505	Intron			XP_016878084.1
XM_017022596.1	505	Intron			XP_016878085.1
XM_017022597.1	505	Intron			XP_016878086.1
XM_017022598.1	505	Intron			XP_016878087.1
XM_017022599.1	505	Intron			XP_016878088.1

Gene

SLC27A2

Gene Name

solute carrier family 27 member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159629.1	505	Silent Mutation	GTA,GTG	V91V	NP_001153101.1
NM_003645.3	505	Silent Mutation	GTA,GTG	V91V	NP_003636.2

View Full Product Details