Product Details

SNP ID: rs202020451
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:60425819 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCATGCCTGGAGACAAGCTCCAGC[A/G]CCAGCCCTGCTAGAGACTCGCTCAT
Phenotype: MIM: 607740
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C17orf64 PubMed Links

Gene Details

Gene: C17orf64
Gene Name: chromosome 17 open reading frame 64

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181707.2	473	Missense Mutation	ACC,GCC	T30A	NP_859058.2
XM_005257033.4	473	Missense Mutation	ACC,GCC	T63A	XP_005257090.1
XM_005257034.4	473	Missense Mutation	ACC,GCC	T63A	XP_005257091.1
XM_005257035.4	473	UTR 5			XP_005257092.1
XM_005257036.2	473	Missense Mutation	ACC,GCC	T30A	XP_005257093.1
XM_017024166.1	473	UTR 5			XP_016879655.1

Gene: RPL12P38
Gene Name: ribosomal protein L12 pseudogene 38

There are no transcripts associated with this gene.

Gene: USP32
Gene Name: ubiquitin specific peptidase 32

There are no transcripts associated with this gene.

View Full Product Details