Product Details

SNP ID: rs200186487
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49117899 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGAGAAGGCGGTGGAGCTGCTGAA[A/G]GCGGCCCAGGGCTCGGTGAAGCTGG
Phenotype: MIM: 612331 MIM: 603144 MIM: 180740
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C19orf73 PubMed Links

Gene Details

Gene: C19orf73
Gene Name: chromosome 19 open reading frame 73

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018111.2	386	Intron			NP_060581.2

Gene: LIN7B
Gene Name: lin-7 homolog B, crumbs cell polarity complex component

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308419.1	386	Silent Mutation	AAA,AAG	K91K	NP_001295348.1
NM_022165.2	386	Silent Mutation	AAA,AAG	K161K	NP_071448.1
XM_006723323.3	386	Silent Mutation	AAA,AAG	K137K	XP_006723386.1
XM_017027131.1	386	UTR 3			XP_016882620.1

Gene: PPFIA3
Gene Name: PTPRF interacting protein alpha 3

There are no transcripts associated with this gene.

Gene: SNRNP70
Gene Name: small nuclear ribonucleoprotein U1 subunit 70

There are no transcripts associated with this gene.

View Full Product Details