Product Details

SNP ID: rs199996657
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:25823669 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCATCCCAATCTGGCAAAACAAGC[C/T]ACATGGGGCTGCTCGAAGTGTAGTA
Phenotype: MIM: 606210
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AUNIP PubMed Links

Gene Details

Gene: AUNIP
Gene Name: aurora kinase A and ninein interacting protein

There are no transcripts associated with this gene.

Gene: LOC646471
Gene Name: uncharacterized LOC646471

There are no transcripts associated with this gene.

Gene: MTFR1L
Gene Name: mitochondrial fission regulator 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099625.1	260	Missense Mutation	CCA,CTA	P17L	NP_001093095.1
NM_001099626.1	260	Missense Mutation	CCA,CTA	P17L	NP_001093096.1
NM_001099627.1	260	Missense Mutation	CCA,CTA	P17L	NP_001093097.1
NM_019557.5	260	Missense Mutation	CCA,CTA	P17L	NP_062457.3

Gene: SEPN1
Gene Name: selenoprotein N, 1

There are no transcripts associated with this gene.

View Full Product Details