Product Details

SNP ID

rs200463123

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.2:189677081 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CAAATAAAGACATTTTTTCAGAGTT[G/T]AGTTCAGCAGGTAAGAGAATTTAAC

Phenotype

MIM: 609803

Polymorphism

G/T, Transversion substitution

Allele Nomenclature

Literature Links

ANKAR PubMed Links

Gene Details

Gene

ANKAR

Gene Name

ankyrin and armadillo repeat containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144708.3	1165	Missense Mutation	TTG,TTT	L197F	NP_653309.3
XM_011510673.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508975.1
XM_011510674.1	1165	Missense Mutation	TTG,TTT	L197F	XP_011508976.1
XM_011510675.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508977.1
XM_011510676.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508978.1
XM_011510677.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508979.1
XM_011510679.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508981.1
XM_011510680.1	1165	Missense Mutation	TTG,TTT	L197F	XP_011508982.1
XM_011510681.1	1165	Missense Mutation	TTG,TTT	L197F	XP_011508983.1
XM_011510682.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508984.1
XM_011510685.2	1165	Missense Mutation	TTG,TTT	L45F	XP_011508987.1
XM_011510686.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508988.1
XM_011510687.2	1165	Intron			XP_011508989.1
XM_011510688.1	1165	Missense Mutation	TTG,TTT	L197F	XP_011508990.1
XM_011510689.2	1165	Missense Mutation	TTG,TTT	L197F	XP_011508991.1
XM_011510691.2	1165	Intron			XP_011508993.1
XM_011510692.2	1165	Intron			XP_011508994.1
XM_011510693.2	1165	Intron			XP_011508995.1
XM_011510694.2	1165	Intron			XP_011508996.1
XM_017003413.1	1165	Missense Mutation	TTG,TTT	L197F	XP_016858902.1
XM_017003414.1	1165	Missense Mutation	TTG,TTT	L197F	XP_016858903.1
XM_017003415.1	1165	Intron			XP_016858904.1
XM_017003416.1	1165	UTR 5			XP_016858905.1
XM_017003417.1	1165	Missense Mutation	TTG,TTT	L197F	XP_016858906.1
XM_017003418.1	1165	Intron			XP_016858907.1
XM_017003419.1	1165	Intron			XP_016858908.1
XM_017003420.1	1165	Intron			XP_016858909.1

Gene

ASNSD1

Gene Name

asparagine synthetase domain containing 1

There are no transcripts associated with this gene.

View Full Product Details