Product Details
- SNP ID
-
rs202016096
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:104856983 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCGTGAGCGCCGACACGCCGCCGCC[A/T]CACCACGGGCTGCAGACGAGCGTTC
- Phenotype
-
MIM: 602480
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LINC01158
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs200554113] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LINC01158
- Gene Name
- long intergenic non-protein coding RNA 1158
There are no transcripts associated with this gene.
- Gene
- LINC01159
- Gene Name
- long intergenic non-protein coding RNA 1159
There are no transcripts associated with this gene.
- Gene
- POU3F3
- Gene Name
- POU class 3 homeobox 3
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_006236.2 |
2916 |
Silent Mutation |
CCA,CCT |
P491P |
NP_006227.1 |
View Full Product Details