Product Details

SNP ID: rs200378080
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:109465895 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTGGCGTTGGCTGGGGCACGTGGT[A/G]AGTGGGTGGTGGCGGACCAGGCTCC
Phenotype: MIM: 607129 MIM: 614064
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MICAL1 PubMed Links

Gene Details

Gene: MICAL1
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159291.1	2218	Intron			NP_001152763.1
NM_001286613.1	2218	UTR 5			NP_001273542.1
NM_022765.3	2218	Intron			NP_073602.3

Gene: ZBTB24
Gene Name: zinc finger and BTB domain containing 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164313.1	2218	Intron			NP_001157785.1
NM_014797.2	2218	Missense Mutation	CAC,TAC	H684Y	NP_055612.2

View Full Product Details