Product Details

SNP ID: rs200323689
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:136953019 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGGCCGCTTTGAGGTGTGGAATG[C/T]GATGACTCGGTGAGTGGCTGTCCCT
Phenotype: MIM: 120930 MIM: 609072 MIM: 612905
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C8G PubMed Links

Gene Details

Gene: C8G
Gene Name: complement component 8, gamma polypeptide

There are no transcripts associated with this gene.

Gene: FBXW5
Gene Name: F-box and WD repeat domain containing 5

There are no transcripts associated with this gene.

Gene: LCN12
Gene Name: lipocalin 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_178536.3	430	Missense Mutation	GCG,GTG	A81V	NP_848631.2
XM_006717065.3	430	Missense Mutation	GCG,GTG	A81V	XP_006717128.1
XM_011518560.2	430	Missense Mutation	GCG,GTG	A108V	XP_011516862.1
XM_011518561.2	430	Missense Mutation	GCG,GTG	A109V	XP_011516863.2
XM_011518562.2	430	Missense Mutation	GCG,GTG	A81V	XP_011516864.1
XM_017014631.1	430	Missense Mutation	GCG,GTG	A109V	XP_016870120.1
XM_017014632.1	430	Missense Mutation	GCG,GTG	A109V	XP_016870121.1

View Full Product Details