Product Details

SNP ID: rs200713134
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:49206588 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTAAATCCTCACAACTGCCCTGGC[A/G]CTGCAGACACTGGATGGTGAAGGAG
Phenotype: MIM: 300110 MIM: 313475
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CACNA1F PubMed Links

Gene Details

Gene: CACNA1F
Gene Name: calcium voltage-gated channel subunit alpha1 F

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256789.2	2663	Missense Mutation	CGC,TGC	R1799C	NP_001243718.1
NM_001256790.2	2663	Missense Mutation	CGC,TGC	R1745C	NP_001243719.1
NM_005183.3	2663	Missense Mutation	CGC,TGC	R1810C	NP_005174.2
XM_011543983.2	2663	Missense Mutation	CGC,TGC	R1738C	XP_011542285.1
XM_017029836.1	2663	Missense Mutation	CGC,TGC	R860C	XP_016885325.1

Gene: SYP
Gene Name: synaptophysin

There are no transcripts associated with this gene.

Gene: SYP-AS1
Gene Name: SYP antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details