Product Details

SNP ID: rs11845687
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.14:74242456 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTTTAAAACGGCCTATCCTCACC[C/G]CTTAGGCCCTAATAGGTTTTGGCTT
Phenotype: MIM: 142993
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: VSX2 PubMed Links
Additional Information: For this assay, SNP(s) [rs117447114,rs77732635] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182894.2		Intron			NP_878314.1