Product Details

SNP ID

rs12495674

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.3:197046263 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCATAGTTTAGGTTGACAACAGCAC[A/G]CAAGGATTTATTTTAGGAGAAAACA

Phenotype

MIM: 601014

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

DLG1 PubMed Links

Additional Information

For this assay, SNP(s) [rs113876435] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DLG1

Gene Name

discs large MAGUK scaffold protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098424.1		Intron			NP_001091894.1
NM_001204386.1		Intron			NP_001191315.1
NM_001204387.1		Intron			NP_001191316.1
NM_001204388.1		Intron			NP_001191317.1
NM_001290983.1		Intron			NP_001277912.1
NM_004087.2		Intron			NP_004078.2
XM_005269289.3		Intron			XP_005269346.1
XM_011512502.2		Intron			XP_011510804.1
XM_011512503.1		Intron			XP_011510805.1
XM_011512505.1		Intron			XP_011510807.1
XM_011512506.1		Intron			XP_011510808.1
XM_011512509.1		Intron			XP_011510811.1
XM_017005800.1		Intron			XP_016861289.1
XM_017005801.1		Intron			XP_016861290.1
XM_017005802.1		Intron			XP_016861291.1
XM_017005803.1		Intron			XP_016861292.1
XM_017005804.1		Intron			XP_016861293.1
XM_017005805.1		Intron			XP_016861294.1
XM_017005806.1		Intron			XP_016861295.1
XM_017005807.1		Intron			XP_016861296.1
XM_017005808.1		Intron			XP_016861297.1
XM_017005809.1		Intron			XP_016861298.1
XM_017005810.1		Intron			XP_016861299.1
XM_017005811.1		Intron			XP_016861300.1
XM_017005812.1		Intron			XP_016861301.1
XM_017005813.1		Intron			XP_016861302.1
XM_017005814.1		Intron			XP_016861303.1
XM_017005815.1		Intron			XP_016861304.1
XM_017005816.1		Intron			XP_016861305.1
XM_017005817.1		Intron			XP_016861306.1
XM_017005818.1		Intron			XP_016861307.1
XM_017005819.1		Intron			XP_016861308.1
XM_017005820.1		Intron			XP_016861309.1
XM_017005821.1		Intron			XP_016861310.1
XM_017005822.1		Intron			XP_016861311.1
XM_017005823.1		Intron			XP_016861312.1
XM_017005824.1		Intron			XP_016861313.1

View Full Product Details