Product Details

SNP ID: rs5936549
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:70282204 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGCGTTGGAAGCCATTTTGGCTGCA[A/G]CCTACCTGAAGCGATGTCTGCCTTT
Phenotype: MIM: 301770 MIM: 300521 MIM: 300632
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARR3 PubMed Links

Gene Details

Gene: ARR3
Gene Name: arrestin 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004312.2	1227	Intron			NP_004303.2
XM_017029518.1	1227	Intron			XP_016885007.1

Gene: KIF4A
Gene Name: kinesin family member 4A

There are no transcripts associated with this gene.

Gene: PDZD11
Gene Name: PDZ domain containing 11

There are no transcripts associated with this gene.

Gene: RAB41
Gene Name: RAB41, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001032726.2	1227	UTR 5			NP_001027898.2
XM_011530948.2	1227	UTR 5			XP_011529250.1
XM_017029488.1	1227	UTR 5			XP_016884977.1

View Full Product Details