Product Details

SNP ID: rs1806158
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:31817240 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGCTTTACGCGCTGCCCAGCTCTGT[C/G]GGCCGCATTCTTTCGTACTCCGCGT
Phenotype: MIM: 607108
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DKFZp686K1684 PubMed Links

Gene Details

Gene: DKFZp686K1684
Gene Name: uncharacterized LOC440034

There are no transcripts associated with this gene.

Gene: PAUPAR
Gene Name: PAX6 upstream antisense RNA

There are no transcripts associated with this gene.

Gene: PAX6
Gene Name: paired box 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000280.4		Intron			NP_000271.1
NM_001127612.1		Intron			NP_001121084.1
NM_001258462.1		Intron			NP_001245391.1
NM_001258463.1		Intron			NP_001245392.1
NM_001258464.1		Intron			NP_001245393.1
NM_001258465.1		Intron			NP_001245394.1
NM_001310158.1		Intron			NP_001297087.1
NM_001310159.1		Intron			NP_001297088.1
NM_001310160.1		Intron			NP_001297089.1
NM_001310161.1		Intron			NP_001297090.1
NM_001604.5		Intron			NP_001595.2

View Full Product Details