Product Details

SNP ID: rs2086362
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144492239 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCAGAGGGCAGGCAGGCTCACTTC[C/T]CTCTGGCTCCCCAGCACTGTGAGTC
Phenotype: MIM: 138200 MIM: 609172
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GPT PubMed Links

Gene Details

Gene: GPT
Gene Name: glutamic--pyruvic transaminase

There are no transcripts associated with this gene.

Gene: LOC101928953
Gene Name: uncharacterized LOC101928953

There are no transcripts associated with this gene.

Gene: PPP1R16A
Gene Name: protein phosphatase 1 regulatory subunit 16A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005272350.2		Intron			XP_005272407.1
XM_011517349.2		Intron			XP_011515651.1
XM_017013912.1		Intron			XP_016869401.1
XM_017013913.1		Intron			XP_016869402.1
XM_017013914.1		Intron			XP_016869403.1
XM_017013915.1		Intron			XP_016869404.1

View Full Product Details