Product Details

SNP ID: rs2232109
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:43876892 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAGGCCTGCCAGTGCCCGGAAGCC[A/G]TCGCCCTGTTTCTCCATCTGGGCTG
Phenotype: MIM: 611986 MIM: 610337
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MRPS24 PubMed Links

Gene Details

Gene: MRPS24
Gene Name: mitochondrial ribosomal protein S24

There are no transcripts associated with this gene.

Gene: URGCP
Gene Name: upregulator of cell proliferation

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077663.2	3060	Silent Mutation	GAC,GAT	D857D	NP_001071131.1
NM_001077664.2	3060	Silent Mutation	GAC,GAT	D814D	NP_001071132.1
NM_001290075.1	3060	Silent Mutation	GAC,GAT	D814D	NP_001277004.1
NM_001290076.1	3060	Silent Mutation	GAC,GAT	D814D	NP_001277005.1
NM_017920.4	3060	Silent Mutation	GAC,GAT	D848D	NP_060390.3

Gene: URGCP-MRPS24
Gene Name: URGCP-MRPS24 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204871.1	3060	Intron			NP_001191800.1

View Full Product Details