Product Details

SNP ID: rs55641018
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:46247126 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTACCCACCGGGCCCACACACACC[A/C]GCCTGCTGCACAAACTGCAGCACGA
Phenotype: MIM: 604670 MIM: 170998
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CDPF1 PubMed Links

Gene Details

Gene: CDPF1
Gene Name: cysteine rich DPF motif domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207327.4	633	Missense Mutation	CGG,CTG	R70L	NP_997210.3
XM_011529960.1	633	Missense Mutation	CGG,CTG	R70L	XP_011528262.1
XM_011529962.2	633	Missense Mutation	CGG,CTG	R70L	XP_011528264.1
XM_011529963.1	633	Silent Mutation	GCG,GCT	A69A	XP_011528265.1
XM_011529964.1	633	Silent Mutation	GCG,GCT	A69A	XP_011528266.1
XM_011529965.2	633	Missense Mutation	CGG,CTG	R70L	XP_011528267.1

Gene: PKDREJ
Gene Name: polycystin (PKD) family receptor for egg jelly

There are no transcripts associated with this gene.

Gene: PPARA
Gene Name: peroxisome proliferator activated receptor alpha

There are no transcripts associated with this gene.

View Full Product Details