Product Details

SNP ID: rs35273378
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:97020904 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGGAGGGTGGGCATGAGGGTGGTG[G/T]CTGAGCGAGCGGGACGAGCCCTGGG
Phenotype: MIM: 600028 MIM: 600030
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DLX5 PubMed Links

Gene Details

Gene: DLX5
Gene Name: distal-less homeobox 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005221.5	2021	Silent Mutation	AGG,AGT	R234S	NP_005212.1
XM_005250185.3	2021	Silent Mutation	AGG,AGT	R106S	XP_005250242.1
XM_017011803.1	2021	Silent Mutation	AGG,AGT	R106S	XP_016867292.1

Gene: DLX6
Gene Name: distal-less homeobox 6

There are no transcripts associated with this gene.

Gene: DLX6-AS1
Gene Name: DLX6 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details