Product Details
- SNP ID
-
rs7510754
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:46050878 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- AGGAAAGGTGGTATCAGGGAGTCTG[A/G]GCATCTGAACCTCCCCAGGGGACTG
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LINC00899
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7510795] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LINC00899
- Gene Name
- long intergenic non-protein coding RNA 899
There are no transcripts associated with this gene.
- Gene
- PRR34
- Gene Name
- proline rich 34
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_018280.2 |
1417 |
UTR 3 |
|
|
NP_060750.1 |
- Gene
- PRR34-AS1
- Gene Name
- PRR34 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details