Product Details

SNP ID: rs3737984
Assay Type: Functionally tested
NCBI dbSNP Submissions: 72
Location: Chr.1:53243178 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: GATGAGTGTATGGCTGGAGTTCGGG[G/T]GGTAGGGTGGAGAGGCTTGCATTCC
Phenotype: MIM: 602600 MIM: 602603
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC100507564 PubMed Links

Gene Details

Gene: LOC100507564
Gene Name: uncharacterized LOC100507564

There are no transcripts associated with this gene.

Gene: LRP8
Gene Name: LDL receptor related protein 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018054.2	6969	UTR 3			NP_001018064.1
NM_004631.4	6969	UTR 3			NP_004622.2
NM_017522.4	6969	UTR 3			NP_059992.3
NM_033300.3	6969	UTR 3			NP_150643.2
XM_005271173.3	6969	Intron			XP_005271230.1
XM_005271174.3	6969	Intron			XP_005271231.1
XM_005271175.3	6969	Intron			XP_005271232.1
XM_006710881.3	6969	Intron			XP_006710944.1
XM_006710882.3	6969	Intron			XP_006710945.1
XM_011542094.2	6969	Intron			XP_011540396.1
XM_011542095.2	6969	Intron			XP_011540397.1
XM_011542096.2	6969	Intron			XP_011540398.1
XM_017002265.1	6969	Intron			XP_016857754.1
XM_017002266.1	6969	Intron			XP_016857755.1
XM_017002267.1	6969	Intron			XP_016857756.1
XM_017002268.1	6969	Intron			XP_016857757.1

Gene: MAGOH
Gene Name: mago homolog, exon junction complex core component

There are no transcripts associated with this gene.

View Full Product Details