Product Details
- SNP ID
-
rs10512786
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:130683704 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AAGAGCTATTATTTATCAAGCATTA[A/G]TTGTGTGCTAGAGTATGTATTTTGC
- Phenotype
-
MIM: 616613
MIM: 602610
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
COL6A6
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs78693657] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- COL6A6
- Gene Name
- collagen type VI alpha 6
There are no transcripts associated with this gene.
- Gene
- PIK3R4
- Gene Name
- phosphoinositide-3-kinase regulatory subunit 4
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_014602.2 |
|
Intron |
|
|
NP_055417.1 |
View Full Product Details