Product Details

SNP ID: rs9912317
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7922377 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTTTTAAATCAAGGCGTCCCTGCC[C/T]GTGACGGAAAGGCTGTCACTAATTC
Phenotype: MIM: 602120 MIM: 611425 MIM: 604111 MIM: 610969
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHD3 PubMed Links

Gene Details

Gene: CHD3
Gene Name: chromodomain helicase DNA binding protein 3

There are no transcripts associated with this gene.

Gene: CNTROB
Gene Name: centrobin, centriole duplication and spindle assembly protein

There are no transcripts associated with this gene.

Gene: KCNAB3
Gene Name: potassium voltage-gated channel subfamily A regulatory beta subunit 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004732.3	1798	UTR 3			NP_004723.2
XM_011524068.1	1798	UTR 3			XP_011522370.1
XM_017025304.1	1798	UTR 3			XP_016880793.1
XM_017025305.1	1798	UTR 3			XP_016880794.1
XM_017025306.1	1798	UTR 3			XP_016880795.1

Gene: LOC284023
Gene Name: uncharacterized LOC284023

There are no transcripts associated with this gene.

Gene: TRAPPC1
Gene Name: trafficking protein particle complex 1

There are no transcripts associated with this gene.

View Full Product Details