Product Details

SNP ID: rs7108844
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:77620052 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCCTCACAAAGTGAAAAGACAAAAA[C/T]CAGTACAGCAAGCTTTTTGCTTATT
Phenotype: MIM: 609914 MIM: 602158
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AQP11 PubMed Links

Gene Details

Gene: AQP11
Gene Name: aquaporin 11

There are no transcripts associated with this gene.

Gene: CLNS1A
Gene Name: chloride nucleotide-sensitive channel 1A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001293.2		Intron			NP_001284.1
NM_001311199.1		Intron			NP_001298128.1
NM_001311200.1		Intron			NP_001298129.1
NM_001311201.1		Intron			NP_001298130.1
NM_001311202.1		Intron			NP_001298131.1

Gene: LOC107987163
Gene Name: uncharacterized LOC107987163

There are no transcripts associated with this gene.

View Full Product Details