Product Details

SNP ID: hCV31990697
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.9:72057523 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTACAGGTGTGAGCCATCGCACCAG[A/G]CTAAAATTATTTTTTATTTTGAGAG
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: C9orf57 PubMed Links
Additional Information: For this assay, SNP(s) [rs77331784] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.