Product Details

SNP ID: rs11546375
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:206159982 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTCTCGGATACAGCCGACACCAT[G/T]GGTTTCGGAGACCTGAAAAGCCCTG
Phenotype: MIM: 600655 MIM: 157655
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: EEF1B2 PubMed Links

Gene Details

Gene: EEF1B2
Gene Name: eukaryotic translation elongation factor 1 beta 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037663.1	389	Intron			NP_001032752.1
NM_001959.3	389	Missense Mutation	ATG,ATT	M1I	NP_001950.1
NM_021121.3	389	Intron			NP_066944.1

Gene: NDUFS1
Gene Name: NADH:ubiquinone oxidoreductase core subunit S1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199981.1	389	Intron			NP_001186910.1
NM_001199982.1	389	Intron			NP_001186911.1
NM_001199983.1	389	Intron			NP_001186912.1
NM_001199984.1	389	Intron			NP_001186913.1
NM_005006.6	389	Intron			NP_004997.4
XM_017004188.1	389	Intron			XP_016859677.1

Gene: SNORA41
Gene Name: small nucleolar RNA, H/ACA box 41

There are no transcripts associated with this gene.

Gene: SNORD51
Gene Name: small nucleolar RNA, C/D box 51

There are no transcripts associated with this gene.

View Full Product Details