Product Details

SNP ID: rs41275227
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:102457563 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCATGCTTCCACTGGTGCCGTGCC[A/G]CCCCGGTGAGGACCAGCAGGGAGCG
Phenotype: MIM: 613302 MIM: 615167 MIM: 610929
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALKBH4 PubMed Links

Gene Details

Gene: ALKBH4
Gene Name: alkB homolog 4, lysine demethylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017621.3	778	Missense Mutation	GCG,GTG	A247V	NP_060091.1
XM_005250464.2	778	Missense Mutation	GCG,GTG	A174V	XP_005250521.1
XM_005250465.2	778	Missense Mutation	GCG,GTG	A109V	XP_005250522.1

Gene: LRWD1
Gene Name: leucine rich repeats and WD repeat domain containing 1

There are no transcripts associated with this gene.

Gene: MIR5090
Gene Name: microRNA 5090

There are no transcripts associated with this gene.

Gene: ORAI2
Gene Name: ORAI calcium release-activated calcium modulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001126340.2	778	Intron			NP_001119812.1
NM_001271818.1	778	Intron			NP_001258747.1
NM_001271819.1	778	Intron			NP_001258748.1
NM_032831.3	778	Intron			NP_116220.1

View Full Product Details