Product Details

SNP ID: rs62057932
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:66935460 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCCACCTATGACTGCTCAGTCCC[A/G]CTCTCCTACCACACCCACCTTTCCC
Phenotype: MIM: 605278 MIM: 614778 MIM: 179503
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CES2 PubMed Links

Gene Details

Gene: CES2
Gene Name: carboxylesterase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003869.5	1017	Missense Mutation	CAC,CGC	H6R	NP_003860.2
NM_198061.2	1017	Missense Mutation	CAC,CGC	H6R	NP_932327.1
XM_011523421.2	1017	UTR 5			XP_011521723.1
XM_017023818.1	1017	UTR 5			XP_016879307.1

Gene: FAM96B
Gene Name: family with sequence similarity 96 member B

There are no transcripts associated with this gene.

Gene: RRAD
Gene Name: RRAD, Ras related glycolysis inhibitor and calcium channel regulator

There are no transcripts associated with this gene.

View Full Product Details