Product Details

SNP ID: rs72955444
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219229951 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTTACGCGGGCCAGTTGTTGCTGG[G/T]CGCATGGGTAACGAAGAAAGTTCGG
Phenotype: MIM: 612204
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ANKZF1 PubMed Links

Gene Details

Gene: ANKZF1
Gene Name: ankyrin repeat and zinc finger domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042410.1	64	UTR 5			NP_001035869.1
NM_001282792.1	64	Intron			NP_001269721.1
NM_018089.2	64	Intron			NP_060559.2
XM_005246663.2	64	Intron			XP_005246720.1
XM_011511392.2	64	Intron			XP_011509694.1
XM_017004420.1	64	Intron			XP_016859909.1
XM_017004421.1	64	Intron			XP_016859910.1

Gene: ATG9A
Gene Name: autophagy related 9A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077198.2	64	Intron			NP_001070666.1
NM_024085.4	64	Intron			NP_076990.4

Gene: GLB1L
Gene Name: galactosidase beta 1 like

There are no transcripts associated with this gene.

View Full Product Details