Product Details

SNP ID

rs11987380

Assay Type

Validated

NCBI dbSNP Submissions

NA

Location

Chr.8:52114934 on Build GRCh38

Set Membership

Validated

Context Sequence [VIC/FAM]

TTAACTTGTGTGGTACCTGTTTTTT[A/C]TGGCAGTGGTGAAGAAGAAAATACT

Phenotype

Polymorphism

A/C, Transversion Substitution

Allele Nomenclature

Literature Links

ST18 PubMed Links

Additional Information

For this assay, SNP(s) [rs75914145] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ST18

Gene Name

ST18, C2H2C-type zinc finger

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014682.2		Intron			NP_055497.1
XM_006716487.1		Intron			XP_006716550.1
XM_011517629.1		Intron			XP_011515931.1
XM_011517631.1		Intron			XP_011515933.1
XM_011517632.1		Intron			XP_011515934.1
XM_011517633.1		Intron			XP_011515935.1
XM_011517634.1		Intron			XP_011515936.1
XM_011517635.1		Intron			XP_011515937.1
XM_011517636.2		Intron			XP_011515938.1
XM_011517637.1		Intron			XP_011515939.1
XM_011517638.2		Intron			XP_011515940.1
XM_011517641.1		Intron			XP_011515943.1
XM_011517642.1		Intron			XP_011515944.1
XM_017014047.1		Intron			XP_016869536.1
XM_017014048.1		Intron			XP_016869537.1
XM_017014049.1		Intron			XP_016869538.1
XM_017014050.1		Intron			XP_016869539.1
XM_017014051.1		Intron			XP_016869540.1
XM_017014052.1		Intron			XP_016869541.1
XM_017014053.1		Intron			XP_016869542.1
XM_017014054.1		Intron			XP_016869543.1
XM_017014055.1		Intron			XP_016869544.1
XM_017014056.1		Intron			XP_016869545.1
XM_017014057.1		Intron			XP_016869546.1
XM_017014058.1		Intron			XP_016869547.1
XM_017014059.1		Intron			XP_016869548.1
XM_017014060.1		Intron			XP_016869549.1
XM_017014061.1		Intron			XP_016869550.1
XM_017014062.1		Intron			XP_016869551.1
XM_017014063.1		Intron			XP_016869552.1
XM_017014064.1		Intron			XP_016869553.1
XM_017014065.1		Intron			XP_016869554.1
XM_017014066.1		Intron			XP_016869555.1
XM_017014067.1		Intron			XP_016869556.1
XM_017014068.1		Intron			XP_016869557.1
XM_017014069.1		Intron			XP_016869558.1
XM_017014070.1		Intron			XP_016869559.1
XM_017014071.1		Intron			XP_016869560.1
XM_017014072.1		Intron			XP_016869561.1
XM_017014073.1		Intron			XP_016869562.1
XM_017014074.1		Intron			XP_016869563.1
XM_017014075.1		Intron			XP_016869564.1
XM_017014076.1		Intron			XP_016869565.1
XM_017014077.1		Intron			XP_016869566.1
XM_017014078.1		Intron			XP_016869567.1
XM_017014079.1		Intron			XP_016869568.1
XM_017014080.1		Intron			XP_016869569.1
XM_017014081.1		Intron			XP_016869570.1
XM_017014082.1		Intron			XP_016869571.1
XM_017014083.1		Intron			XP_016869572.1
XM_017014084.1		Intron			XP_016869573.1

View Full Product Details