Product Details

SNP ID: rs632324
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:32730324 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCCCTAGAGCCCTAGATGCAATCA[C/T]AAGTGTCCTTATAACAGGGAGGCAG
Phenotype: MIM: 604297
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PAXBP1 PubMed Links

Gene Details

Gene: PAXBP1
Gene Name: PAX3 and PAX7 binding protein 1

There are no transcripts associated with this gene.

Gene: PAXBP1-AS1
Gene Name: PAXBP1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: SYNJ1
Gene Name: synaptojanin 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001160302.1		Intron			NP_001153774.1
NM_001160306.1		Intron			NP_001153778.1
NM_003895.3		Intron			NP_003886.3
NM_203446.2		Intron			NP_982271.2

View Full Product Details