Product Details

SNP ID: rs11652516
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:44195218 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GTTAGATGTTTCTTTCTGTATAAAT[A/G]CTAGATAGCACAAGCAGAGATGGCC
Phenotype: MIM: 600673
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ASB16-AS1 PubMed Links

Gene Details

Gene: ASB16-AS1
Gene Name: ASB16 antisense RNA 1

There are no transcripts associated with this gene.

Gene: ATXN7L3
Gene Name: ataxin 7 like 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098833.1		Intron			NP_001092303.1
NM_020218.1		Intron			NP_064603.1
XM_011525038.2		Intron			XP_011523340.1
XM_011525044.2		Intron			XP_011523346.1
XM_011525046.2		Intron			XP_011523348.1
XM_017024880.1		Intron			XP_016880369.1
XM_017024881.1		Intron			XP_016880370.1
XM_017024882.1		Intron			XP_016880371.1
XM_017024883.1		Intron			XP_016880372.1
XM_017024884.1		Intron			XP_016880373.1
XM_017024885.1		Intron			XP_016880374.1
XM_017024886.1		Intron			XP_016880375.1

Gene: LOC101926967
Gene Name: uncharacterized LOC101926967

There are no transcripts associated with this gene.

Gene: TMUB2
Gene Name: transmembrane and ubiquitin like domain containing 2

There are no transcripts associated with this gene.

Gene: UBTF
Gene Name: upstream binding transcription factor, RNA polymerase I

There are no transcripts associated with this gene.

View Full Product Details