Product Details

SNP ID: rs12370
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:93934560 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGAGAGGGAGGCAGCCTGCAGCCTC[A/G]TCTGTCACCAGGTCCCCTTGGAGTT
Phenotype: MIM: 605759
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ASB2 PubMed Links

Gene Details

Gene: ASB2
Gene Name: ankyrin repeat and SOCS box containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001202429.1	2284	UTR 3			NP_001189358.1
NM_016150.4	2284	UTR 3			NP_057234.2
XM_005267758.3	2284	UTR 3			XP_005267815.1
XM_011536834.2	2284	UTR 3			XP_011535136.1
XM_011536835.2	2284	UTR 3			XP_011535137.1
XM_017021369.1	2284	UTR 3			XP_016876858.1

Gene: FAM181A
Gene Name: family with sequence similarity 181 member A

There are no transcripts associated with this gene.

Gene: FAM181A-AS1
Gene Name: FAM181A antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details