Product Details

SNP ID: rs11222364
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:130868695 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCAACCCCCCGACCACACCCCATG[A/C]CCAGTATACTCTTAGAGCAGAGAGG
Phenotype
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LOC100507431 PubMed Links

Gene Details

Gene: LOC100507431
Gene Name: uncharacterized LOC100507431

There are no transcripts associated with this gene.

Gene: LOC103611081
Gene Name: uncharacterized LOC103611081

There are no transcripts associated with this gene.

Gene: SNX19
Gene Name: sorting nexin 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301089.1	11483	Intron			NP_001288018.1
NM_014758.2	11483	Intron			NP_055573.2
XM_005271546.4	11483	UTR 3			XP_005271603.1
XM_011542819.2	11483	UTR 3			XP_011541121.1
XM_011542820.2	11483	UTR 3			XP_011541122.1
XM_011542821.2	11483	UTR 3			XP_011541123.1
XM_011542822.2	11483	Intron			XP_011541124.1
XM_011542824.2	11483	UTR 3			XP_011541126.1
XM_011542825.2	11483	UTR 3			XP_011541127.1
XM_011542826.2	11483	UTR 3			XP_011541128.1
XM_011542827.2	11483	UTR 3			XP_011541129.1
XM_017017725.1	11483	UTR 3			XP_016873214.1
XM_017017726.1	11483	UTR 3			XP_016873215.1

View Full Product Details