Product Details

SNP ID: rs7297662
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:56001594 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAAGGGGGTACTACTGTACTTGTTG[A/G]CTCTTCATGTTAGCTCTGCTAGGCA
Phenotype: MIM: 606239 MIM: 179514 MIM: 606887
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IKZF4 PubMed Links

Gene Details

Gene: IKZF4
Gene Name: IKAROS family zinc finger 4

There are no transcripts associated with this gene.

Gene: LOC105369781
Gene Name: uncharacterized LOC105369781

There are no transcripts associated with this gene.

Gene: RAB5B
Gene Name: RAB5B, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: SUOX
Gene Name: sulfite oxidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000456.2		Intron			NP_000447.2
NM_001032386.1		Intron			NP_001027558.1
NM_001032387.1		Intron			NP_001027559.1
XM_005269112.1		Intron			XP_005269169.1
XM_017019905.1		Intron			XP_016875394.1
XM_017019906.1		Intron			XP_016875395.1
XM_017019907.1		Intron			XP_016875396.1
XM_017019908.1		Intron			XP_016875397.1

View Full Product Details