Product Details

SNP ID

rs1633550

Assay Type

Validated

NCBI dbSNP Submissions

NA

Location

Chr.11:113798483 on Build GRCh38

Set Membership

HapMap Validated

Context Sequence [VIC/FAM]

TTTGGGCCAGCAGTAGCCCTATTGA[C/G]TGTTTTTGACAATTTTTAGGTATTA

Phenotype

MIM: 610748

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

LOC390251 PubMed Links

Additional Information

For this assay, SNP(s) [rs114628994] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

LOC390251

Gene Name

SH3 domain containing GRB2 like 1 pseudogene

There are no transcripts associated with this gene.

Gene

USP28

Gene Name

ubiquitin specific peptidase 28

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301029.1	4245	UTR 3			NP_001287958.1
NM_020886.3	4245	UTR 3			NP_065937.1
XM_005271630.2	4245	UTR 3			XP_005271687.1
XM_005271631.2	4245	UTR 3			XP_005271688.1
XM_005271632.2	4245	UTR 3			XP_005271689.1
XM_005271633.4	4245	UTR 3			XP_005271690.1
XM_005271636.2	4245	UTR 3			XP_005271693.1
XM_005271637.2	4245	UTR 3			XP_005271694.1
XM_005271638.2	4245	UTR 3			XP_005271695.1
XM_005271639.2	4245	UTR 3			XP_005271696.1
XM_011542936.2	4245	UTR 3			XP_011541238.1
XM_011542938.1	4245	UTR 3			XP_011541240.1
XM_011542941.1	4245	UTR 3			XP_011541243.1
XM_011542942.1	4245	UTR 3			XP_011541244.1
XM_017018056.1	4245	UTR 3			XP_016873545.1
XM_017018057.1	4245	UTR 3			XP_016873546.1
XM_017018058.1	4245	UTR 3			XP_016873547.1
XM_017018059.1	4245	UTR 3			XP_016873548.1
XM_017018060.1	4245	UTR 3			XP_016873549.1
XM_017018061.1	4245	UTR 3			XP_016873550.1
XM_017018062.1	4245	UTR 3			XP_016873551.1
XM_017018063.1	4245	UTR 3			XP_016873552.1
XM_017018064.1	4245	UTR 3			XP_016873553.1
XM_017018065.1	4245	UTR 3			XP_016873554.1
XM_017018066.1	4245	UTR 3			XP_016873555.1
XM_017018067.1	4245	UTR 3			XP_016873556.1
XM_017018068.1	4245	UTR 3			XP_016873557.1
XM_017018069.1	4245	Intron			XP_016873558.1

View Full Product Details