Product Details

SNP ID
rs2290455
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.17:75591187 on Build GRCh38
Set Membership
HapMap Validated
Context Sequence [VIC/FAM]
TCTCCCTCAGACACATCTTTGCCAT[C/T]GTGGCATCAGCCTATGACCTGGCTC
Phenotype
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
MYO15B PubMed Links
Additional Information
For this assay, SNP(s) [rs80252608] are located under a probe and SNP(s) [rs147655466] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
MYO15B
Gene Name
myosin XVB
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001309242.1 2235 Silent Mutation ATC,ATT I792I NP_001296171.1
XM_017025120.1 2235 Silent Mutation ATC,ATT I574I XP_016880609.1
XM_017025121.1 2235 Silent Mutation ATC,ATT I574I XP_016880610.1
XM_017025122.1 2235 Silent Mutation ATC,ATT I574I XP_016880611.1
XM_017025123.1 2235 Silent Mutation ATC,ATT I574I XP_016880612.1
XM_017025124.1 2235 Silent Mutation ATC,ATT I574I XP_016880613.1
XM_017025125.1 2235 Silent Mutation ATC,ATT I574I XP_016880614.1
XM_017025126.1 2235 Silent Mutation ATC,ATT I574I XP_016880615.1
XM_017025127.1 2235 Silent Mutation ATC,ATT I345I XP_016880616.1
XM_017025128.1 2235 Silent Mutation ATC,ATT I336I XP_016880617.1
XM_017025129.1 2235 Silent Mutation ATC,ATT I53I XP_016880618.1
XM_017025130.1 2235 Silent Mutation ATC,ATT I50I XP_016880619.1
XM_017025131.1 2235 Silent Mutation ATC,ATT I15I XP_016880620.1
XM_017025132.1 2235 UTR 5 XP_016880621.1
XM_017025133.1 2235 Intron XP_016880622.1
XM_017025134.1 2235 UTR 5 XP_016880623.1
XM_017025135.1 2235 Intron XP_016880624.1
XM_017025136.1 2235 Intron XP_016880625.1
XM_017025137.1 2235 Intron XP_016880626.1
XM_017025138.1 2235 Intron XP_016880627.1
XM_017025139.1 2235 Intron XP_016880628.1
XM_017025140.1 2235 Intron XP_016880629.1
XM_017025141.1 2235 Silent Mutation ATC,ATT I574I XP_016880630.1
XM_017025142.1 2235 Silent Mutation ATC,ATT I574I XP_016880631.1
XM_017025143.1 2235 Intron XP_016880632.1
XM_017025144.1 2235 UTR 5 XP_016880633.1

View Full Product Details